Skip to main content
U.S. flag

An official website of the United States government

Cold-water Coral Microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: Raw Data

August 24, 2018

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype." They represent a 16S rRNA gene amplicon survey of the corals' microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with the Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5' AYTGGGYDTAAAGNG, rev: 5' CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from bacteria in the Chlamydiales order from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5' GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5' TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the NCBI Sequence Read Archive under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. For more information, please see the README file.

Goldsmith, D.B., Kellogg, C.A., Morrison C.L., Gray, M.A., Stone, R.P., Waller, R.G., Brooke, S.D., and Ross, S.W., 2018, Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype: Scientific Reports, v. 8, Art. 12383,

Citation Information

Publication Year 2018
Title Cold-water Coral Microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: Raw Data
DOI 10.5066/F7P55KMJ
Authors Christina A Kellogg, Dawn B Goldsmith
Product Type Data Release
Record Source USGS Digital Object Identifier Catalog
USGS Organization St. Petersburg Coastal and Marine Science Center